ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
A collaborative platform for members of SIB core facilities

Core Facilities Focus Group

SIB Facilities

The SIB bioinformatics core facilities are centralized resources within research institutions or universities that provide computational and analytical support for biological research. They assist with analyzing large-scale biological datasets, such as those generated by genomics, proteomics, metabolomics, and transcriptomics studies. The main tasks involve expert consultation on experimental design, data interpretation, and statistical analysis. The facilities develop and maintain custom software tools and pipelines tailored to specific research questions. Additionally, SIB facilities offer training and education through workshops, seminars, and one-on-one sessions, supporting data analysis, storage, management, and sharing to ensure secure and efficient handling of large datasets. They also manage high-performance computing infrastructure to meet the computational demands of large-scale bioinformatics analyses.

About the SIB focus groups

The focus groups aim to foster knowledge exchanges and collaborations in the community of 900 SIB Members, around specific scientific and/or transversal topics, from single-cell sequencing to equality, diversity and inclusion. View all focus groups

Focus Group

The "Core Facilities Focus Group" provides a collaborative platform for members of SIB core facilities to exchange experiences and best practices. Alongside topics specific to facilities, like project management, time tracking, and financial models, we also address broader challenges in bioinformatics. This encompasses standardizing data analysis, developing and sharing workflows, and promoting reproducible research.

About the SIB focus groups

The focus groups aim to foster knowledge exchanges and collaborations in the community of 900 SIB Members, around specific scientific and/or transversal topics, from single-cell sequencing to equality, diversity and inclusion. View all focus groups

With many institutes adopting embedded bioinformaticians, fostering regular interaction between them and core facilities, and integrating them into the SIB bioinformatics community belongs to our main focus. It serves as a dynamic forum for optimizing processes and sharing knowledge within and beyond bioinformatics cores.

Focus Group coordinating members:

Are you a SIB Member and interested in joining? Do you wish to join the dedicated Slack channel? Contact Robert Ivanek