ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Boosting bioinformatics skills

Training

Our comprehensive – and constantly evolving – course portfolio provides hands-on experience of the most up-to-date bioinformatics techniques and resources, including clinical applications for researchers or healthcare professionals. We offer about 100 course-days per year. Gain high-quality introductory and advanced data science expertise in specific area. Our course portfolio can be tailored to meet the needs of your company as private courses, offered on-site or online: find out more about our specific offer for companies.

Case study

Develop programming and data analysis skills in your team

The challenge

Onboarding a group of employees with mixed skills levels in R programming language and RNA-seq data analysis, and on a tight schedule.

Our solution

We adapt courses to create a training path adjusted to your schedule constraints and team-specific needs.

A picture representing a lecturer and a student.

Who do we train

Through our Training group , we provide a rich course offering to students...
Illustration visualising an artificial neural network as physical objects

We are dedicated to empowering your research and projects, whether you are in:

  • Academia or public-private consortia
  • Hospital or clinic
  • Start-up, SME, pharma or large company

What they say about us

Pierre Fabre Laboratories logo

SIB’s expertise has been invaluable to unlock the potential of our plant samples collection, which is being studied by our academic partners. Using the latest technology, SIB integrated information from various sources including taxonomy, mass spectrometry and biological results from 1600 plant extracts into a single, easy-to-use database, to support the search for drug candidates against tuberculosis and obesity.

Florence Guillaume

Head of Green Mission Department, Pierre Fabre Laboratories

HUG logo

Collaborating with SIB has been a clear positive for our laboratory. The OncoBench ® programme that we developed together has greatly simplified our workflows and increased our efficiency, while preserving the security of our patients’ personal data.

Thomas A. McKee

Associate Physician and Unit Manager, Clinical Pathology Service, Geneva University Hospitals (HUG)

Amazentis logo

We pride ourselves on insisting on the highest standards of scientific rigour and the SIB proved to be an outstanding partner. Its leading expertise in bioinformatics and unique position as a not-for-profit organization made it an ideal partner for our first in-human clinical trial, which resulted in one of the highest-ranked publications to date in Nature Metabolism.

Chris Rinsch

CEO and Co-Founder, Amazentis

QCMD Logo

The combination of QCMD’s EQA expertise and global network with SIB’s bioinformatics know-how will help shape the quality assessment schemes in this rapidly developing area of molecular diagnostics.

Elaine McCulloch

Technical Project Manager, QCMD

ENYO Pharma SA logo

The collaboration allowed us to make the protein-protein interaction data from ENYO easily discoverable to all, through the fantastic knowledge platform dedicated to human proteins that is neXtProt. We are happy to contribute to enabling their use by all researchers studying and interpreting protein networks in health and disease.

Laurène Meyniel-Schicklin, Co-Founder

Co-Founder, ENYO Pharma SA

Our partners

Member of