ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG



UniProt: Focus on Plant Proteins
02 June 2025
02 June 2025
For-profit: 0 CHF
This webinar will be streamed to registered participants only.
Overview
Are you working on plants and struggling to find information about plant proteins? Are you curious about the biosynthesis of natural compounds like caffeine, capsaicin, and others? Are you interested in the interactions between plant and pathogens? If so, this webinar is for you.
UniProt is the world’s leading high-quality, comprehensive and freely accessible resource of protein sequence and functional information. UniProtKB/Swiss-Prot curators manually extract information from the scientific literature, including plant proteins. UniProt also provides protein sets (proteomes) for plant species with sequenced genomes.
Starting with a biological question (i.e., how to get the list of enzymes involved in the synthesis of CBD or THC), you will explore the different ways of answering it, using UniProt. Hints on how to extend queries to other biological contexts will also be provided.
This 1-h webinar will introduce the plant-related data in UniProt and how to find it.
Audience
This webinar is for beginners interested in protein enzymes.
Learning outcomes
At the end of this webinar, the participants are expected to:
- describe the information on plant proteins found in UniProt, focussing on plant enzymes
- use the advanced search to query UniProt for plant protein information
- recall how to find complete plant proteomes
- know where to find help, documentation and get support
Prerequisites
Knowledge / competencies
Knowledge of biology and plants is required for this course.
While this course is designed for beginners, we suggest you view the video Inside expert biocuration in UniProtKB/Swiss-Prot prior to the lecture.
Technical
This webinar will be streamed; you are thus required to have your own computer with an Internet connection.
Application
Attendance is free-of-charge; however, registration is mandatory.
You will be informed by email of your registration confirmation.
Venue and Time
This webinar will be streamed using Zoom. It will start at 15:00 CET (09:00 EST) and end around 16:00 CET (10:00 EST).
All registered participants will receive the information for connecting remotely by email one working day prior to the webinar.
Additional information
Coordination: Monique Zahn, SIB Training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.