ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Peer-reviewed papers and preprints by our members

Scientific publications 2025

Bioinformatics has become essential to convert biological questions into answers. Discover the breadth of our scientists' work and contributions through their publications. 

 

Source: Europe PMC, latest update: 11.03.25

Discover the SIB Remarkable Outputs 2024

The Remarkable Outputs are selected by the Award Committee to provide the community with the yearly achievements by SIB Scientists that are particularly deserving attention. From new algorithms to detect disease-related genes to exploring the origins of sexual reproduction, discover this shortlist of publications, software tools, databases and outreach projects.

  1. Aparo A, Avesani S, Parmigiani L, Napoli S, Bertoni F, Bonnici V, Cascione L, Giugno R. EasyCircR: Detection and reconstruction of circular RNAs post-transcriptional regulatory interaction networks. Comput Biol Med 2025;188:109846
  2. Barbera MC, Guarrera L, Re Cecconi AD, Cassanmagnago GA, Vallerga A, Lunardi M, Checchi F, Di Rito L, Romeo M, Mapelli SN, Schoser B, Generozov EV, Molecular Genetics Group, Jansen R, de Geus EJC, Penninx B, van Dongen J, Craparotta I, Piccirillo R, Ahmetov II, Bolis M. Increased ectodysplasin-A2-receptor EDA2R is a ubiquitous hallmark of aging and mediates parainflammatory responses. Nat Commun 2025;16(1):1898
  3. Bastian FB, Cammarata AB, Carsanaro S, Detering H, Huang WT, Joye S, Niknejad A, Nyamari M, Mendes de Farias T, Moretti S, Tzivanopoulou M, Wollbrett J, Robinson-Rechavi M. Bgee in 2024: focus on curated single-cell RNA-seq datasets, and query tools. Nucleic Acids Res 2025;53(d1):D878-D885
  4. Bağcı C, Nuhamunada M, Goyat H, Ladanyi C, Sehnal L, Blin K, Kautsar SA, Tagirdzhanov A, Gurevich A, Mantri S, von Mering C, Udwary D, Medema MH, Weber T, Ziemert N. BGC Atlas: a web resource for exploring the global chemical diversity encoded in bacterial genomes. Nucleic Acids Res 2025;53(d1):D618-D624
  5. Blum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, Pinto BL, Orr A, Paysan-Lafosse T, Ponamareva I, Salazar GA, Bordin N, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunic I, Llinares-López F, Marchler-Bauer A, Meng-Papaxanthos L, Mi H, Natale DA, Orengo CA, Pandurangan AP, Piovesan D, Rivoire C, Sigrist CJA, Thanki N, Thibaud-Nissen F, Thomas PD, Tosatto SCE, Wu CH, Bateman A. InterPro: the protein sequence classification resource in 2025. Nucleic Acids Res 2025;53(d1):D444-D456
  6. Bramon Mora B, Lindsay H, Thiébaut A, Stuart KD, Gottardo R. tagtango: an application to compare single-cell annotations. Bioinformatics 2025;41(2):btaf012
  7. Chen Z, Tsui JL, Cai J, Su S, Viboud C, du Plessis L, Lemey P, Kraemer MUG, Yu H. Disruption of seasonal influenza circulation and evolution during the 2009 H1N1 and COVID-19 pandemics in Southeastern Asia. Nat Commun 2025;16(1):475
  8. Cherrak Y, Younes AA, Perez-Molphe-Montoya E, Maurer L, Yilmaz K, Enz U, Zeder C, Kiefer P, Christen P, Gül E, Vorholt JA, von Mering C, Hardt WD. Neutrophil recruitment during intestinal inflammation primes Salmonella elimination by commensal E. coli in a context-dependent manner. Cell Host Microbe 2025:S1931-3128(25)00052-6
  9. Chiva C, Olivella R, Staes A, Mendes Maia T, Panse C, Stejskal K, Douché T, Lombard B, Schuhmann A, Loew D, Mechtler K, Matondo M, Rettel M, Helm D, Impens F, Devos S, Shevchenko A, Nanni P, Sabidó E. A Multiyear Longitudinal Harmonization Study of Quality Controls in Mass Spectrometry Proteomics Core Facilities. J Proteome Res 2025;24(2):397-409
  10. Dmitrijeva M, Ruscheweyh HJ, Feer L, Li K, Miravet-Verde S, Sintsova A, Mende DR, Zeller G, Sunagawa S. The mOTUs online database provides web-accessible genomic context to taxonomic profiling of microbial communities. Nucleic Acids Res 2025;53(d1):D797-D805
  11. Feuermann M, Mi H, Gaudet P, Muruganujan A, Lewis SE, Ebert D, Mushayahama T, Gene Ontology Consortium, Thomas PD. A compendium of human gene functions derived from evolutionary modelling. Nature 2025
  12. Geng A, Brenig RG, Roux J, Lütge M, Cheng HW, Flint EE, Lussier POG, Meier MA, Pop OT, Künzler-Heule P, Matter MS, Wendon J, McPhail MJW, Soysal S, Semela D, Heim M, Weston CJ, Ludewig B, Bernsmeier C. Circulating monocytes upregulate CD52 and sustain innate immune function in cirrhosis unless acute decompensation emerges. J Hepatol 2025:S0168-8278(24)02818-6
  13. Glaus AN, Brechet M, Swinnen G, Lebeigle L, Iwaszkiewicz J, Ambrosini G, Julca I, Zhang J, Roberts R, Iseli C, Guex N, Jiménez-Gómez J, Glover N, Martin GB, Strickler S, Soyk S. Repairing a deleterious domestication variant in a floral regulator gene of tomato by base editing. Nat Genet 2025;57(1):231-241
  14. Hinz FB, Masters MR, Nguyen JT, Mahmoud AH, Lill MA. Accelerated Hydration Site Localization and Thermodynamic Profiling. J Chem Inf Model 2025
  15. Huang YH, Escalona HE, Sun YF, Zhang PF, Du XY, Gong SR, Tang XF, Liang YS, Yang D, Chen PT, Yang HY, Chen ML, Hüttel B, Hlinka O, Wang X, Meusemann K, Ślipiński A, Zwick A, Waterhouse RM, Misof B, Niehuis O, Li HS, Pang H. Molecular evolution of dietary shifts in ladybird beetles (Coleoptera: Coccinellidae): from fungivory to carnivory and herbivory. BMC Biol2025;23(1):67
  16. Jamy M, Huber T, Antoine T, Ruscheweyh H, Paoli L, Pelletier E, Delmont TO, Burki F. New deep-branching environmental plastid genomes on the algal tree of life 2025
  17. Komarov N, Fritsch C, Maier GL, Bues J, Biočanin M, Avalos CB, Dodero A, Kwon JY, Deplancke B, Sprecher SG. Food hardness preference reveals multisensory contributions of fly larval gustatory organs in behaviour and physiology. PLoS Biol 2025;23(1):e3002730
  18. Koptekin D, Yapar E, Vural KB, Sağlıcan E, Altınışık NE, Malaspinas AS, Alkan C, Somel M. Pre-processing of paleogenomes: mitigating reference bias and postmortem damage in ancient genome data. Genome Biol 2025;26(1):6
  19. Koutsovoulos GD, Poullet M, Elashry A, Kozlowski DKL, Sallet E, Da Rocha M, Perfus-Barbeoch L, Martin-Jimenez C, Frey JE, Ahrens CH, Kiewnick S, Danchin EGJ. Retraction Note: Genome assembly and annotation of Meloidogyne enterolobii, an emerging parthenogenetic root-knot nematode. Sci Data 2025;12(1):183
  20. Kraemer MUG, Tsui JL, Chang SY, Lytras S, Khurana MP, Vanderslott S, Bajaj S, Scheidwasser N, Curran-Sebastian JL, Semenova E, Zhang M, Unwin HJT, Watson OJ, Mills C, Dasgupta A, Ferretti L, Scarpino SV, Koua E, Morgan O, Tegally H, Paquet U, Moutsianas L, Fraser C, Ferguson NM, Topol EJ, Duchêne DA, Stadler T, Kingori P, Parker MJ, Dominici F, Shadbolt N, Suchard MA, Ratmann O, Flaxman S, Holmes EC, Gomez-Rodriguez M, Schölkopf B, Donnelly CA, Pybus OG, Cauchemez S, Bhatt S. Artificial intelligence for modelling infectious disease epidemics.Nature 2025;638(8051):623-635
  21. Kraft A, Kirschner MB, Orlowski V, Ronner M, Bodmer C, Boeva V, Opitz I, Meerang M. Exploring RNA cargo in extracellular vesicles for pleural mesothelioma detection. BMC Cancer2025;25(1):212
  22. Kuipers J, Anıl Tuncel M, Ferreira PF, Jahn K, Beerenwinkel N. Single-cell copy number calling and event history reconstruction. Bioinformatics 2025:btaf072
  23. Kweon H, Burik CAP, Ning Y, Ahlskog R, Xia C, Abner E, Bao Y, Bhatta L, Faquih TO, de Feijter M, Fisher P, Gelemanović A, Giannelis A, Hottenga JJ, Khalili B, Lee Y, Li-Gao R, Masso J, Myhre R, Palviainen T, Rietveld CA, Teumer A, Verweij RM, Willoughby EA, Agerbo E, Bergmann S, Boomsma DI, Børglum AD, Brumpton BM, Davies NM, Esko T, Gordon SD, Homuth G, Ikram MA, Johannesson M, Kaprio J, Kidd MP, Kutalik Z, Kwong ASF, Lee JJ, Luik AI, Magnus P, Marques-Vidal P, Martin NG, Mook-Kanamori DO, Mortensen PB, Oskarsson S, Pedersen EM, Polašek O, Rosendaal FR, Smart MC, Snieder H, van der Most PJ, Vollenweider P, Völzke H, Willemsen G, Beauchamp JP, DiPrete TA, Linnér RK, Lu Q, Morris TT, Okbay A, Harden KP, Abdellaoui A, Hill WD, de Vlaming R, Benjamin DJ, Koellinger PD. Associations between common genetic variants and income provide insights about the socio-economic health gradient. Nat Hum Behav 2025
  24. Majidian S, Nevers Y, Yazdizadeh Kharrazi A, Warwick Vesztrocy A, Pascarelli S, Moi D, Glover N, Altenhoff AM, Dessimoz C. Orthology inference at scale with FastOMA. Nat Methods2025;22(2):269-272
  25. Marquez J, Cuendet MA, Caino-Lores S, Estrada T, Deelman E, Weinstein H, Taufer M. Increasing the Efficiency of Ensemble Molecular Dynamics Simulations with Termination of Unproductive Trajectories Identified at Runtime. J Phys Chem A 2025;129(9):2317-2324
  26. Massara M, Ballabio M, Dolfi B, Morad G, Wischnewski V, Lamprou E, Lourenco J, Claudinot S, Gallart-Ayala H, Méndez RS, Kauzlaric A, Fournier N, Damania AV, Wong MC, Ivanisevic J, Ajami NJ, Wargo JA, Joyce JA. The bacterial microbiome modulates the initiation of brain metastasis by impacting the gut-to-brain axis. iScience 2025;28(2):111874
  27. Modesto M, Scarafile D, Vásquez A, Pukall R, Neumann-Schaal M, Pascarelli S, Sgorbati B, Ancora M, Cammà C, Mattarelli P, Olofsson TC. Phylogenetic characterization of Bifidobacterium kimbladii sp. nov., a novel species from the honey stomach of the honeybee Apis mellifera. Syst Appl Microbiol 2025;48(1):126579
  28. Molari M, Shaw LP, Neher RA. Quantifying the Evolutionary Dynamics of Structure and Content in Closely Related E. coli Genomes. Mol Biol Evol 2025;42(1):msae272
  29. Moon Y, Herrmann CJ, Mironov A, Zavolan M. PolyASite v3.0: a multi-species atlas of polyadenylation sites inferred from single-cell RNA-sequencing data. Nucleic Acids Res2025;53(d1):D197-D204
  30. Moortele TV, Verschaffelt P, Huang Q, Doncheva NT, Holstein T, Jachmann C, Dawyndt P, Martens L, Mesuere B, Van Den Bossche T. PathwayPilot: A User-Friendly Tool for Visualizing and Navigating Metabolic Pathways. Mol Cell Proteomics 2025:100918
  31. Muench P, Fiumara M, Southern N, Coda D, Aschenbrenner S, Correia B, Gräff J, Niopek D, Mathony J. A modular toolbox for the optogenetic deactivation of transcription. Nucleic Acids Res2025;53(3):gkae1237
  32. Ordon J, Logemann E, Maier LP, Lee T, Dahms E, Oosterwijk A, Flores-Uribe J, Miyauchi S, Paoli L, Stolze SC, Nakagami H, Felix G, Garrido-Oter R, Ma KW, Schulze-Lefert P. Conserved immunomodulation and variation in host association by Xanthomonadales commensals in Arabidopsis root microbiota. Nat Plants 2025
  33. Pla-Díaz M, Akgül G, Molak M, du Plessis L, Panagiotopoulou H, Doan K, Bogdanowicz W, Dąbrowski P, Oziembłowski M, Kwiatkowska B, Szczurowski J, Grzelak J, Arora N, Majander K, González-Candelas F, Schuenemann VJ. Insights into Treponema pallidum genomics from modern and ancient genomes using a novel mapping strategy. BMC Biol 2025;23(1):7
  34. Rosenberg NA, Stadler T, Steel M. "A mathematical theory of evolution": phylogenetic models dating back 100 years. Philos Trans R Soc Lond B Biol Sci 2025;380(1919):20230297
  35. Saelens W, Pushkarev O, Deplancke B. ChromatinHD connects single-cell DNA accessibility and conformation to gene expression through scale-adaptive machine learning. Nat Commun2025;16(1):317
  36. Samarasinghe KW, Kotlyar M, Vallet SD, Hayes C, Naba A, Jurisica I, Lisacek F, Ricard-Blum S. MatrixDB 2024: an increased coverage of extracellular matrix interactions, a new Network Explorer and a new web interface. Nucleic Acids Res 2025;53(d1):D1677-D1682
  37. Schubert C, Nguyen BD, Sichert A, Näpflin N, Sintsova A, Feer L, Näf J, Daniel BBJ, Steiger Y, von Mering C, Sauer U, Hardt WD. Monosaccharides drive Salmonella gut colonization in a context-dependent or -independent manner. Nat Commun 2025;16(1):1735
  38. Schuhknecht L, Ortmayr K, Jänes J, Bläsi M, Panoussis E, Bors S, Dorčáková T, Fuhrer T, Beltrao P, Zampieri M. A human metabolic map of pharmacological perturbations reveals drug modes of action. Nat Biotechnol 2025
  39. Skribbe M, Soneson C, Stadler MB, Schwaiger M, Suma Sreechakram VN, Iesmantavicius V, Hess D, Moreno EPF, Braun S, Seebacher J, Smallwood SA, Bühler M. A comprehensive Schizosaccharomyces pombe atlas of physical transcription factor interactions with proteins and chromatin. Mol Cell 2025:S1097-2765(25)00099-1
  40. Strütt S, Excoffier L, Peischl S. A generalized structured coalescent for purifying selection without recombination. Genetics 2025:iyaf013
  41. Sun M, Garnier L, Chevalier R, Roumain M, Wang C, Angelillo J, Montorfani J, Pick R, Brighouse D, Fournier N, Tarussio D, Tissot S, Lobaccaro JM, Petrova TV, Jandus C, Speiser DE, Kopf M, Pot C, Scheiermann C, Homicsko K, Muccioli GG, Garg AD, Hugues S. Lymphatic-derived oxysterols promote anti-tumor immunity and response to immunotherapy in melanoma. Nat Commun 2025;16(1):1217
  42. Szklarczyk D, Nastou K, Koutrouli M, Kirsch R, Mehryary F, Hachilif R, Hu D, Peluso ME, Huang Q, Fang T, Doncheva NT, Pyysalo S, Bork P, Jensen LJ, von Mering C. The STRING database in 2025: protein networks with directionality of regulation. Nucleic Acids Res 2025;53(d1):D730-D737
  43. Tauriello G, Waterhouse AM, Haas J, Behringer D, Bienert S, Garello T, Schwede T. ModelArchive: a deposition database for computational macromolecular structural models. J Mol Biol2025:168996
  44. Tegenfeldt F, Kuznetsov D, Manni M, Berkeley M, Zdobnov EM, Kriventseva EV. OrthoDB and BUSCO update: annotation of orthologs with wider sampling of genomes. Nucleic Acids Res2025;53(d1):D516-D522
  45. Topaloudis A, Cumer T, Lavanchy E, Ducrest AL, Simon C, Machado AP, Paposhvili N, Roulin A, Goudet J. The recombination landscape of the barn owl, from families to populations. Genetics2025;229(1):1-50
  46. Triscott J, Lehner M, Benjak A, Reist M, Emerling BM, Ng CKY, de Brot S, Rubin MA. Loss of PI5P4Kα Slows the Progression of a Pten Mutant Basal Cell Model of Prostate Cancer. Mol Cancer Res 2025;23(1):33-45
  47. Truman K, Vaughan TG, Gavryushkin A, Gavryushkina AS. The Fossilized Birth-Death Model Is Identifiable. Syst Biol 2025;74(1):112-123
  48. Träger LK, Degen M, Pereira J, Durairaj J, Teixeira RD, Hiller S, Huguenin-Dezot N. Structural basis for cooperative ssDNA binding by bacteriophage protein filament P12. Nucleic Acids Res2025;53(5):gkaf132
  49. Van Hecke M, Beerenwinkel N, Lootens T, Fostier J, Raedt R, Marchal K. ELLIPSIS: robust quantification of splicing in scRNA-seq. Bioinformatics 2025;41(2):btaf028
  50. Wolski WE, Grossmann J, Schwarz L, Leary P, Türker C, Nanni P, Schlapbach R, Panse C. <i>prolfquapp</i> ─ A User-Friendly Command-Line Tool Simplifying Differential Expression Analysis in Quantitative Proteomics. J Proteome Res 2025;24(2):955-965
  51. Yang L, Sadler MC, Altman RB. Genetic association studies using disease liabilities from deep neural networks. Am J Hum Genet 2025:S0002-9297(25)00019-9
  52. Zdouc MM, Blin K, Louwen NLL, Navarro J, Loureiro C, Bader CD, Bailey CB, Barra L, Booth TJ, Bozhüyük KAJ, Cediel-Becerra JDD, Charlop-Powers Z, Chevrette MG, Chooi YH, D'Agostino PM, de Rond T, Del Pup E, Duncan KR, Gu W, Hanif N, Helfrich EJN, Jenner M, Katsuyama Y, Korenskaia A, Krug D, Libis V, Lund GA, Mantri S, Morgan KD, Owen C, Phan CS, Philmus B, Reitz ZL, Robinson SL, Singh KS, Teufel R, Tong Y, Tugizimana F, Ulanova D, Winter JM, Aguilar C, Akiyama DY, Al-Salihi SAA, Alanjary M, Alberti F, Aleti G, Alharthi SA, Rojo MYA, Arishi AA, Augustijn HE, Avalon NE, Avelar-Rivas JA, Axt KK, Barbieri HB, Barbosa JCJ, Barboza Segato LG, Barrett SE, Baunach M, Beemelmanns C, Beqaj D, Berger T, Bernaldo-Agüero J, Bettenbühl SM, Bielinski VA, Biermann F, Borges RM, Borriss R, Breitenbach M, Bretscher KM, Brigham MW, Buedenbender L, Bulcock BW, Cano-Prieto C, Capela J, Carrion VJ, Carter RS, Castelo-Branco R, Castro-Falcón G, Chagas FO, Charria-Girón E, Chaudhri AA, Chaudhry V, Choi H, Choi Y, Choupannejad R, Chromy J, Donahey MSC, Collemare J, Connolly JA, Creamer KE, Crüsemann M, Cruz AA, Cumsille A, Dallery JF, Damas-Ramos LC, Damiani T, de Kruijff M, Martín BD, Sala GD, Dillen J, Doering DT, Dommaraju SR, Durusu S, Egbert S, Ellerhorst M, Faussurier B, Fetter A, Feuermann M, Fewer DP, Foldi J, Frediansyah A, Garza EA, Gavriilidou A, Gentile A, Gerke J, Gerstmans H, Gomez-Escribano JP, González-Salazar LA, Grayson NE, Greco C, Gomez JEG, Guerra S, Flores SG, Gurevich A, Gutiérrez-García K, Hart L, Haslinger K, He B, Hebra T, Hemmann JL, Hindra H, Höing L, Holland DC, Holme JE, Horch T, Hrab P, Hu J, Huynh TH, Hwang JY, Iacovelli R, Iftime D, Iorio M, Jayachandran S, Jeong E, Jing J, Jung JJ, Kakumu Y, Kalkreuter E, Kang KB, Kang S, Kim W, Kim GJ, Kim H, Kim HU, Klapper M, Koetsier RA, Kollten C, Kovács ÁT, Kriukova Y, Kubach N, Kunjapur AM, Kushnareva AK, Kust A, Lamber J, Larralde M, Larsen NJ, Launay AP, Le NT, Lebeer S, Lee BT, Lee K, Lev KL, Li SM, Li YX, Licona-Cassani C, Lien A, Liu J, Lopez JAV, Machushynets NV, Macias MI, Mahmud T, Maleckis M, Martinez-Martinez AM, Mast Y, Maximo MF, McBride CM, McLellan RM, Bhatt KM, Melkonian C, Merrild A, Metsä-Ketelä M, Mitchell DA, Müller AV, Nguyen GS, Nguyen HT, Niedermeyer THJ, O'Hare JH, Ossowicki A, Ostash BO, Otani H, Padva L, Paliyal S, Pan X, Panghal M, Parade DS, Park J, Parra J, Rubio MP, Pham HT, Pidot SJ, Piel J, Pourmohsenin B, Rakhmanov M, Ramesh S, Rasmussen MH, Rego A, Reher R, Rice AJ, Rigolet A, Romero-Otero A, Rosas-Becerra LR, Rosiles PY, Rutz A, Ryu B, Sahadeo LA, Saldanha M, Salvi L, Sánchez-Carvajal E, Santos-Medellin C, Sbaraini N, Schoellhorn SM, Schumm C, Sehnal L, Selem N, Shah AD, Shishido TK, Sieber S, Silviani V, Singh G, Singh H, Sokolova N, Sonnenschein EC, Sosio M, Sowa ST, Steffen K, Stegmann E, Streiff AB, Strüder A, Surup F, Svenningsen T, Sweeney D, Szenei J, Tagirdzhanov A, Tan B, Tarnowski MJ, Terlouw BR, Rey T, Thome NU, Torres Ortega LR, Tørring T, Trindade M, Truman AW, Tvilum M, Udwary DW, Ulbricht C, Vader L, van Wezel GP, Walmsley M, Warnasinghe R, Weddeling HG, Weir ANM, Williams K, Williams SE, Witte TE, Rocca SMW, Yamada K, Yang D, Yang D, Yu J, Zhou Z, Ziemert N, Zimmer L, Zimmermann A, Zimmermann C, van der Hooft JJJ, Linington RG, Weber T, Medema MH. MIBiG 4.0: advancing biosynthetic gene cluster curation through global collaboration. Nucleic Acids Res 2025;53(d1):D678-D690
  53. Zwaans A, Seidel S, Manceau M, Stadler T. A Bayesian phylodynamic inference framework for single-cell CRISPR/Cas9 lineage tracing barcode data with dependent target sites. Philos Trans R Soc Lond B Biol Sci 2025;380(1919):20230318
  54. de Korne-Elenbaas J, Caduff L, Lison A, McLeod R, Pitton M, Gan C, Julian TR. Design, validation, and implementation of multiplex digital PCR assays for simultaneous quantification of multiple targets. Lett Appl Microbiol 2025;78(1):ovae137
  55. de Vries PLM, Baud D, Baggio S, Ceulemans M, Favre G, Gerbier E, Legardeur H, Maisonneuve E, Pena-Reyes C, Pomar L, Winterfeld U, Panchaud A. Enhancing perinatal health patient information through ChatGPT - An accuracy study. PEC Innov 2025;6:100381

Browse other years