ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Discover ViralZone
17 January 2023
17 January 2023
For-profit: 0 CHF
This course will be streamed to registered participants only.
Overview
ViralZone is a SIB Swiss Institute of Bioinformatics web resource for all viral genera and families. It provides molecular biology information on all kind of viruses, and bridges knowledge to virus or sequence databases. For each virus or family page, ViralZone provides easy access to the corresponding UniProtKB/Swiss-Prot and GenBank viral protein entries. It also contains virion and genome images.
This 2 h course introduces the ViralZone resource, a knowledge resource to understand virus diversity, and will include 2 Q&A sessions.
Audience
This course is addressed to students, postdocs, and researchers, from any scientific environment (academia, facilities, companies, etc.) interested in viral data. It should also be of interest to any person looking for virion and viral genome images for use in teaching or publications.
Learning outcomes
At the end of the webinar, the participants are expected to:
- describe the scope of ViralZone
- list the sources of the information
- explain how the information is organized
- state uses of the ViralZone resource
- list where to find help, documentation and get support
Prerequisites
Knowledge / competencies
Knowledge of the basic molecular biology is presumed. No bioinformatics competencies are required.
Technical
This webinar will be streamed, you are thus required to have your own computer with an Internet connection.
Application
Attendance is free-of-charge; however, registration is mandatory (use the Apply button below).
There is no limit on the number of participants.
Venue and Time
This webinar will be streamed using Zoom. It will start at 15:00 CET (09:00 EST) and end around 17:00 CET (11:30 EST).
All registered participants will receive the information for remotely connecting to the online meeting room by email one working day before the webinar.
Additional information
Coordination: Monique Zahn, SIB training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.