ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Gene expression made useful easily: tools and database of Bgee (lectures and practicals) - 18 June, 2021

18 June 2021
Streamed
Cancellation deadline:
04 June 2021
Frédéric Bastian, Marc Robinson-Rechavi, Julien Wollbrett, Sara Fonseca Costa
Academic: 60 CHF
For-profit: 300 CHF
0.25 ECTS credits


No future instance of this course is planned yet

This course is now full with a waiting list.

Overview

This is a course on bioinformatics resources taught by the developers of the resources. Bgee is a curated database of gene expression in animals, including model species such as human, mouse or drosophila, and others such as livestock, primates, or fishes. Bgee integrates information from single-cell and bulk RNA-seq, microarrays, and in situ hybridization. These data are available through a web interface and an R package. Bgee also includes tools which use these data, such as TopAnat or Expression Comparison, and allows integration with users' own data through another R package. In this course, we will present the curated and pre-analysed gene expression data in Bgee. Hands-on will be open to make use of the Bgee companion tools, Bgee’s online functionalities, or Bgee R packages to retrieve data and integrate them into one’s own workflow (e.g. RNA-seq analysis R script).

Audience

This course is addressed to life scientists who need to retrieve curated gene expression, obtain expression-based knowledge on genes of interest, or compare expression between genes and between species.

Learning outcomes

After the theoretical course, participants should be able to:

  • Distinguish types of expression data and the added value of curation, annotation, and consistent analysis.
  • Explain the steps of gene expression analysis.
  • Retrieve precomputed gene expression data through the web.

After the hands-on course, participants should be able to either:

Series 1:

  • Use the online tools of Bgee in an expert way (run analyses knowing which options to use, what are the consequences of choices of data to put in, what is more or less reliable or powerful).
  • Interpret biological results obtained with Bgee and associated tools.

Series 2:

  • Use the Bgee R tools and integrate them into their own workflows.
  • Analyse data from species or conditions absent from Bgee
  • Interpret biological results obtained with Bgee and associated tools.

Prerequisites

Knowledge / competencies

Theory and hands-on series 1: none. Knowledge of R is required for hands-on series 2.

Technical

This course will be streamed, you are thus required to have your own computer with an internet connection.

Schedule - CET time zone

9:00-12:15 CET time zone - Online lectures (Frédéric Bastian and Marc Robinson-Rechavi)

  • 9:00-9:10 Welcome
  • 9:10-9:40 Overview of Bgee
  • 9:40-9:50 Q&A
  • 9:50-10:35 Present and absent calls from transcriptome data
  • 10:35-10:50 Q&A
  • 10:50-11:05 Break
  • 11:05-11:35 Data integration in Bgee
  • 11:35-11:45 Q&A
  • 11:45-12:15 Bgee tools

12:15 - 13:15 CET time zone - Lunch break

13:15-17:15 Hands-on, divided into parallel series (Frédéric Bastian, Marc Robinson-Rechavi, Sara Fonseca and Julien Wollbrett).

Series 1: Bgee web tools

  • 13:15-14:45 Around the gene page: finding genes, interpreting scores, orthologs and paralogs
  • 14:45-15:00 Break
  • 15:00-16:00 Advanced use and interpretation of TopAnat
  • 16:00-16:15 Break
  • 16:15-17:00 Download files: expression data and more
  • 17:00-17:15 Final Q&A, conclusion (common with series 2)

Series 2: Bgee R tools

  • 13:15-13:45 Installing Bgee R packages, simple import and manipulation of data
  • 13:45-15:15 Integrating the BgeeDB package into workflows to use curated data and perform TopAnat computations
  • 15:15-15:30 Break
  • 15:30-17:00 Analysing own RNA-Seq data, bulk or single-cell, with the BgeeCall package and the Bgee Zenodo space
  • 17:00-17:15 Final Q&A, conclusion (common with series 1)

Application

The registration fees for academics are 60 CHF and 300 CHF for for-profit companies.

Students are requested to indicate in their application to which series the intent to participate in.

You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.

Applications will close as soon as the places will be filled up. Deadline for free-of-charge cancellation is set to 04.06.2021. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.

Venue and Time

This course will be streamed for registered participants. The course will start at 9:00 and end at 17:15 CET. Precise information will be provided to the participants on due time.

Additional information

Coordination: Valeria Di Cola (valeria.dicola@sib.swiss)

We will recommend 0.25 ECTS credits for this course (given a passed exam at the end of the course).

You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.

Please note that participation in SIB courses is subject to our general conditions.

SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.

For more information, please contact training@sib.swiss.