ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Long-read Sequence Analysis
25 February 2021
For-profit: 600 CHF
Next course(s):
14 - 15 Mar 2022 | Streamed | |
14 - 15 Mar 2023 | Bern | |
07 - 08 Mar 2024 | Bern | |
27 - 28 Feb 2025 | Bern |
This course is now full with a waiting list.
Overview
For the last few years, research in DNA and RNA has been dominated by short-read sequencing. Although this has revolutionized the way we answer biological questions, it has its limitations. One important limitation is read length. The invention of high-throughput long-read sequencing has enabled us to solve questions on genome assembly, haplotyping, structural variation and alternative splicing. In this course, the participant will get acquainted with the major long-read sequencing technologies (PacBio SMRT and Oxford Nanopore Technology), and get experience with hands-on work involving long-read data.
Audience
This course is addressed to people that are working with or will be working with long-read data.
Learning outcomes
At the end of the course, the participants are expected to:
- Understand the basics behind PacBio SMRT sequencing and Oxford Nanopore Technology sequencing
- Use the command line to perform quality control and read alignment of long-read sequencing data
- Be able to do differential isoform expression analysis or a repeat expansion analysis based on long-read sequencing data
Prerequisites
Knowledge / competencies
This course is designed for anyone interested to work with long-read data and there is a requirement for basic UNIX knowledge.
Technical
You are required to bring your own laptop. Software installation instructions will be communicated before the course.
Schedule - CET time zone
Day 1 - 9h00 to 17h
Morning:
- Introduction
- Server login = unix fresh up
Afternoon:
- Quality control and Read alignment
- Applications
Day 2 - 9h00 to 17h
Morning:
- Group Work
Afternoon:
- Group Work
- Presentations
Application
The registration fees for academics are 120 CHF and 600 CHF for for-profit companies.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Deadline for free-of-charge cancellation is set to 25/02/2021. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will be streamed.
The course will start at 9:00 and end around 17:00. Precise information will be provided to the participants in due time.
Additional information
Coordination: Valeria Di Cola
We will recommend 0.5 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.