ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
![](/themes/custom/sib/img/trames/tiny/sm/circle-4-red.png)
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-green.png)
NGS - Genome Variant Analysis
24 November 2020
For-profit: 600 CHF
Next course(s):
30 - 31 Mar 2021 |
|
Streamed |
16 - 17 Sep 2021 |
|
Streamed |
24 - 25 Mar 2022 |
|
Streamed |
26 - 27 Sep 2022 |
|
Bern |
20 - 21 Feb 2023 |
|
Bern |
05 - 06 Sep 2023 |
|
Streamed |
26 - 27 Feb 2024 |
|
Bern |
05 - 06 Sep 2024 |
|
Streamed |
We are sorry but this course is oversubscribed, with a long waiting list. Sign up here to be informed of the next course.
This course will be streamed only for the registered participants. Registered participants will receive specific information directly from the respective course’s organizers.
Overview
The detection of genetic variation is of major interest in various disciplines spanning from ecology and evolution research to inherited disease discovery and precision oncology. Next generation sequencing (NGS) methods are very powerful for the detection of genomic variants. Thanks to its throughput and cost-efficiency it enables the detection of a large number of variants in a large number of samples. In this two-day course we will cover the steps from read alignment to variant calling and annotation. We will mainly focus on the detection of germline mutations by following the GATK best practices.
Audience
This course is intended for life scientists who are already familiar with general concepts of NGS technologies.
Learning objectives
At the end of the course participants should be able to:
- Validate mapping output files
- Perform local realignment to reduce false discovery
- Aligne quality control
- Call variants based on GATK best practices
- Annotate Variants
Prerequisites
Knowledge / competencies:
Participants should have knowledge in NGS techniques, quality control and alignment to a reference genome. Participants should have a basic understanding of working with command line tools on Unix-based systems. You can test your skills with Unix with the quiz here. If you do not feel comfortable with UNIX commands, please take our Unix fundamentals e-learning module.
Technical:
Participants should bring their own computers and chargers (and adapters when coming from abroad).
Application
We are sorry but this course is oversubscribed, with a long waiting list. Sign up [here](http://lists.sib.swiss/mailman/listinfo/courses) to be informed of the next course.The registration fees are 120 CHF for academics and 600 CHF for companies.
Deadline for registration and free-of-charge cancellation is set to November 24. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to this and other general conditions, available here.
You will be informed by email of your registration confirmation.
Location
This course will be streamed.
Schedule
Day 1 - 9h15 to 17h
Morning
- Introduction to Variant discovery
- Fetching sequencing data using Eutilities and SRA tools
- Indexing references & mapping/sorting/indexing alignment
Afternoon
- Differences in workflows between DNA-seq (WGS, WES) and RNA-seq
- Marking duplicates
- Realignment around SNPs and indels
Day 2 - 9h15 to 17h
Morning
- Base quality score recalibration
- Calling the variants (single and multiple samples)
- Joint genotyping
Afternoon
- Variant filtering
- Variant annotation
- Installing used software for a local use
- Optional exam
Additional information
The course will be taught by Geert van Geest.
Coordination: Patricia Palagi, SIB Training Group.
We will recommend 0.5 ECTS credits for this course (given a passed exam at the end of the session).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.