ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
![](/themes/custom/sib/img/trames/tiny/sm/circle-4-green.png)
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-blue.png)
Workshop on Computational Biology at biology'19
01 February 2019
For-profit: 0 CHF
No future instance of this course is planned yet
Overview
SIB is co-organizing a workshop on computational biology on 6 Feb 2019 in Zurich, as a satellite event to Biology 2019, the annual Swiss conference on ecology, evolution, systematics and conservation.
The main objective of this satellite workshop is to raise awareness of students and early career stage researchers about computational tools that can be exploited in their research. The programme is composed of a short introduction of SIB and bioinformatics followed by 3 tutorials on computational biology tools.
Audience
This workshop is addressed to any biologist interested in discovering bioinformatics, some areas of application and its tools.
Programme
14:15-14:30 Grégoire Rossier (Training Group & Vital-IT, SIB Swiss Institute of Bioinformatics), Presentation of the SIB
14:30-15:15 Richard Neher (Microbial Evolution, Biozentrum Basel), Real-time tracking and visualization of pathogen sequence data
15:15-15:45 Coffee break
15:45-16:15 Damian Szklarczyk (Bioinformatics Systems Biology, University of Zurich), The STRING protein-protein interaction database, and its use in characterising functional modularity and enrichment
16:15-17:00 Nicolas Salamin, Daniele Silvestro, Théo Gaboriau (Computational Phylogenetics group), Department of Computational Biology, University of Lausanne, New developments in modeling quantitative traits at the macroevolutionary scale
Prerequisites
Knowledge / competencies
This workshop is designed for beginners and there is no requirement.
Application
Application to the workshop is open at the biology'19 conference website. It is free but reserved to conference participants.
Location & Time
University of Zurich, Irchel Campus
The workshop will start at 14h15 and end around 17:00. Precise information will be provided to the participants on due time.