ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
High Performance Computing for genomic applications
23 November 2018
For-profit: 0 CHF
No future instance of this course is planned yet
Overview
The course "High Performance Computing for genomic applications" is organized for the D-BIOL researchers (including PhD students) by Scientific IT Services on 13-14 December 2018. The main goal of the course is to increase IT competences of researchers and encourage them to use Euler cluster for bioinformatic analyses: independently or together with a bioinformatician in a co-analysis mode.
Some modules include hands-on exercises, so the participants are expected to bring own laptops. On Friday, Dec 14th there is planned a time slot, when the participants can discuss or work on solutions for their own data analysis issues with the instructors.
The course will include on the second day also a module related to cluster use for personalized medicine: "Data & Computing Services for Personalized Health Research"
Application
The classes of the course can be attended or skipped in a "pick-and-mix" mode, depending on the need and skills of the participant, however a registration is required for the full course by filling the form:
https://goo.gl/forms/tscMb9TAURIlWtFI2
The course is limited to 20 participants, confirmations will be sent after the registration process on first-come-first-served basis.
Location
BSSE ETH in Basel
Additional information
Coordination: Michal Okoniewski, Scientific IT Services ETH
Instructors
Michal Okoniewski, Samuel Fux, Diana Coman-Schmid
Schedule
====> High Performance Computing for genomic applications
Day 1, 13 Dec 2018, Erasmus Room
13:00- 13:40 Linux command line re-fresh
13:40- 14:20 Basics of shell scripting
14:20- 14:30 Coffee break
14:30- 15:00 Introduction to the Euler cluster and HPC
15:00- 16:00 LSF queueing system
16:00- 16:30 Genomic formats
16:30- 17:15 Working with genomic data using AWK
Day 2, 14 Dec 2018, Erasmus Room
9:30 - 10:00 Basics of useful R
10:00- 10:30 Basic R scripts for RNA-seq statistics
10:30- 10:45 Coffee break
10:45- 12:00 Genomic software on the Euler cluster
12:00- 13:00 Lunch break
13:00- 13:45 Data & Computing Services for Personalized Health Research
13:45- 14:30 Workflow orchestration with snakemake - demo
14:30- 16:30 Hackaton: participants' own problems and data