ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-green.png)
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-blue.png)
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-red.png)
Comparative Genomics
27 August 2018
For-profit: 900 CHF
No future instance of this course is planned yet
Overview
The aims of this course are to (i) explore key evolutionary concepts, (ii) examine different methodological approaches, and (iii) gain hands-on experience in eukaryotic comparative genomic analyses.
This course will focus on concepts and methods for orthology and paralogy of protein-coding genes, complemented with practical examples of applications of comparative genomics approaches to investigate biological and/or evolutionary questions. It will be structured with lectures in the mornings followed by hands-on sessions in the afternoons.
This course may touch on, but will not cover in any detail, topics relating to genome sequencing and assembly, genome annotation, population genomics, or genomics of prokaryotes.
Audience
This course is aimed at PhD students, postdoctoral and other researchers in the life sciences who are planning how to proceed with comparative genomics analyses to investigate biological or evolutionary questions of importance to their study system.
Learning objectives
At the end of the course participants should be able to:
- Interpret phylogenetic trees and sequence alignments
- Infer orthologs and paralogs using graph- and tree-based methods
- Design and implement comparative analyses to interrogate genomics data, e.g. phylogenomics or gene family dynamics
Prerequisites
Knowledge / competencies:
Participants should have a good understanding of command line tools. If you do not feel comfortable with these UNIX commands, please take our UNIX fundamentals e-learning module.
We also recommend at least a basic knowledge of R, particularly to be able to fully participate in the hands-on exercises.
Technical:
Participants should bring a laptop with at least 8 GB RAM, 50 GB free disk space, and WIFI preinstalled, and the latest version of R.
Application
Registration fees are 180 CHF for academics and 900 CHF for for-profit companies. This includes course content material and coffee breaks. You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Deadline for registration and free-of-charge cancellation is set to 27 August 2018. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to this and other general conditions, available here.
Venue and time
room 2020, Génopode building, University of Lausanne, (Metro M1 line, Sorge station).
The course will start at 9:00 and end around 17:00. Precise information will be provided to the participants on due time.
Schedule
Day 1 - Christophe Dessimoz (UniL and SIB) - Introduction to molecular evolution & phylogenetics
Interpret phylogenetic trees and alignments; general understanding of how trees are inferred; knowing the definition of orthology, paralogy and their subtypes; understanding the difference between pairwise and groupwise comparisons; ability to perform orthology inference through tree overlap method; ability to retrieve orthology information from the OMA database; ability to infer orthologs using the OMA standalone pipeline. Teaching assistants for practical exercises: Natacha Glover, Clément Train and Leonardo de Oliveira Martins.
Day 2 - Robert Waterhouse (UniL and SIB) - Orthology-focused arthropod comparative genomics
Understand the principles of graph-based orthology delineation using OrthoDB as an example; learn how to browse and programmatically query OrthoDB; learn how to use BUSCO to assess genomics data quality; learn how to formulate comparative genomics questions, develop and apply approaches to address them (with a focus on using orthology data), and then critically interpret them, through case studies from arthropods. Teaching assistants for practical exercises: Maarten Reijnders and Mathieu Seppey.
Day 3 - Marc Robinson-Rechavi (UniL and SIB) - Duplication of genes and genomes, expression
Understand the importance of gene and genome duplication in comparative genomics; understand the difficulty of comparing “function” between homologous genes, and know some tools to do so. Teaching assistant for practical exercises: Tina Begum.
Additional information
Coordination: Patricia Palagi
We will recommend 0.75 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.