ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Inside protein databases: bridging sequences and knowledge

09 March 2017
Geneva
Cancellation deadline:
02 March 2017
Pascale Gaudet, Marie-Claude Blatter, Elisabeth Gasteiger
Academic: 50 CHF
For-profit: 0 CHF
0.25 ECTS credits


No future instance of this course is planned yet

Overview

The course will include (1) a description of the major protein sequence databases and their sequence annotation pipeline, focusing on UniProtKB/Swiss-Prot, (2) an introduction to Gene Ontology (GO) and (3) practical sessions allowing to gain knowledge on how to query protein sequence databases, how to perform enrichment analysis on datasets and how to interpret the results of such analyses.

Audience

This course targets biologists and bioinformaticians with little to no experience in analysing biological data.

Learning objectives

At the end of this course, participants are expected to:

  • know the differences between the major protein sequence databases
  • understand the major sequence annotation pipelines and the GO annotation pipelines
  • estimate the protein sequence accuracy and the annotation quality

Prerequisites

Knowledge / competencies: None

Technical: A laptop with internet connexion

Application

The registrations are now open.

The registration fees for academics are 50 CHF. This includes course content material and coffee breaks. Participants from non-academic institutions should contact us before application.

Deadline for registration and free-of-charge cancellation is set is set to 1 March 2017. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to our general conditions, available at https://www.sib.swiss/training/terms-and-conditions. You will be informed by email of your registration confirmation.

Location

University of Geneva, CMU, A04.2711, 1 Michel Servet, 1211 Genève

Additional information

The course will be taught by Pascale Gaudet, CALIPHO Group, SIB, Elisabeth Gasteiger and Marie-Claude Blatter, Swiss-Prot Group, SIB.

Organizers: Marie-Claude Blatter, Swiss-Prot Group, SIB, and Patricia Palagi, SIB Training Group

You are welcome to register to the SIB courses mailing-list to be informed when the registrations for this course will be open, of all future courses and workshops, as well as all important deadlines using the form here.