ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Machine learning for bioinformatics and computational biology
11 October 2016
For-profit: 0 CHF
No future instance of this course is planned yet
This course is organised by the SIB PhD Training Network, SystemsX.ch and the Next Generation Sequencing Discussion Group of the University of Zurich. Priority is given to their members, but is open to everyone.
Overview
This course introduces several important machine learning algorithms used in bioinformatics and illustrates them with examples of applications in the field of genomics, clinic and microbiology.
Audience
Life scientists with basic skills in bioinformatics and statistics.
Learning Objectives
Upon completion of this course, participants are supposed to:
- understand the statistics components and theory of machine learning algorithms
- know how to evaluate machine learning parameters
- be able to select and apply these tools to biological problems
Prerequisites
Knowledge / competencies:
basic mathematical background, knowledge of R and one scripting programming knowledge (Python or Perl for example).
Technical:
Laptop with recent versions of R and Matlab installed, 3 GB of free disk space.
Application
This course is full with a long waiting list, thank you for understanding...
The registration fees for academics are 200 CHF. This includes course content material, coffee breaks, and a social dinner. Participants from non-academic institutions should contact us before application.
Deadline for registration and free-of-charge cancellation is set to November 12, 2016. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to this and other general conditions, available here.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Location
Room Y55-L-06/08, Irchel campus
University of Zurich, Winterthurstrasse 190
Additional information
You are welcome to register to the SIB courses mailing-list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.
General programme
Days 1 & 2: Introduction to Machine Learning: concepts and methods
Dr Frédéric Schütz, University of Lausanne and Bioinformatics Core Facility Group, SIB Swiss Institute of Bioinformatics, Lausanne.
Days 3 to 5: Applications with use cases:
Day 3 - Deep learning methods and cancer genomics
Prof Ivo Kwee, Bioinformatics Core Unit, SIB and Institute of Oncology Research, Bellinzona, Switzerland
Day 4 - Feature selection for biomarker discovery from high-content -omics data
Prof Carlos Peña-Reyes, Computational Intelligence for Computational Biology, HEIG-VD/SIB Swiss Institute of Bioinformatics, Yverdon, Switzerland
Day 5 - Machine Learning and metagenomics to study microbial communities
Dr Luis Pedro Coelho, European Molecular Biology Laboratory (EMBL), Heidelberg, Germany.