ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
neXtProt : Exploring human proteins
14 July 2022
Looking for information about a human protein, such as what mass spectrometry peptides map to its sequence, in which tissues is it expressed or what disease is associated with a sequence variant? This asynchronous e-learning course can be completed online, at the desired pace and in the absence of an instructor.
Overview
neXtProt is a platform that helps researchers answer questions relevant to human proteins. neXtProt is a SIB resource listed in Expasy, the Swiss Bioinformatics Portal.
In this e-learning course, you will learn what type of information is found in neXtProt, where it comes from and how it is organized in topic-specific entry views. Several typical examples of uses of neXtProt will provide ideas on how to use neXtProt for your own research.
Audience
This e-learning course is addressed to users with no or very little knowledge of the neXtProt platform.
Competencies
At the end of the e-learning course, participants should be able to:
- Find information about human proteins
- Use or interpret information about human proteins
Learning outcomes
At the end of the e-learning course, participants are expected to:
- Access the neXtProt website
- Explain what neXtProt is
- Describe the scope and sources of information of the neXtProt
- Provide examples of what the neXtProt can be used for
Prerequisites
Knowledge / competencies
Basic knowledge of biology and proteins is required for this e-learning course. No particular bioinformatics competencies are required.
Technical
None.
Time required
1 hour
Instructions
- Open the module in a browser tab. As the resource is constantly evolving, some of the images may not correspond to the current web site.
- Open a separate browser tab to carry out the exercises and be able to answer the quizzes.
- If you leave a module before the end, your score will be reset to 0.
Additional information
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
For more information, please contact training@sib.swiss.