ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Introduction to Bayesian Statistics with R

28 - 30 November 2022
Basel
Application deadline:
30 September 2022
Cancellation deadline:
14 November 2022
Jack Kuipers, Wandrille Duchemin, Zoltan Kutalik, Simone Tiberi, Timothy Vaughan
Statistics
Intermediate
Academic: 120 CHF
For-profit: 600 CHF
0.75 ECTS credits
Course material




Next course(s):
22 - 24 May 2023 Basel
13 - 14 May 2024 Basel
05 - 06 May 2025 Basel

**The course is now full with a long waiting list. **

Overview

Data analysis is fundamental for arriving at scientific conclusions and testing different model hypotheses. Key to this is understanding uncertainty in our results, and Bayesian statistics offers a framework to quantify and assess the variability in our inference from data. This 3-day course will introduce participants to the core concepts of Bayesian statistics through lectures and applied examples. The first two days of the course will be dedicated to lectures and practical exercises. The practical exercises will be implemented in the widely used R programming language and the Rstan library. They will enable participants to use standard Bayesian statistical tools and interpret their results.

The third day will host a series of talks by experts from SIB groups, who will present state-of-the-art Bayesian methods and their application in the life sciences.

Preliminary program

Day 1 - in person, in Basel

9:00 – 17:00: Jack Kuipers (ETH Zurich and SIB) and Wandrille Duchemin (University of Basel and SIB)

  • T-test recap
  • P-values and confidence intervals
  • Monte Carlo methods
  • Bayesian first steps

Long talk and demo 1 - online

  • 17:15 – 18: 30 Bayesian stochastic modelling in Systems Biology - Simone Tiberi (University of Bologna)

Day 2 - in person, in Basel

9:00 – 17:00: Jack Kuipers (ETH Zurich and SIB) and Wandrille Duchemin (University of Basel and SIB)

  • Bayesian t-tests (STAN + BRMS)
  • Priors
  • Bayesian linear regression
  • Bayesian logistic regression

Long talk and demo 2 - online (cont.)

  • 17:15 – 18: 30 Bayesian approaches for (bulk and single-cell) RNA-seq data - Simone Tiberi (cont.)(University of Bologna)

Day 3 - Long talks and demos - online

  • 10:00 - Informative Bayesian priors boost power in genome-wide association studies - Zoltan Kutalik (University of Lausanne and SIB)
  • 11:00 Coffee break
  • 11:15 - cont. Zoltan Kutalik
  • 12:30 Lunch break
  • 14:00 – Bayesian foundations of Phylogenetic and Phylodynamic inference – Timothy Vaughan (BSSE-ETHZ and SIB)
  • 15:00 Coffee break
  • 15:15 – cont. Timothy Vaughan
  • 16:30 Close

Audience

This course is intended for life scientists familiar with statistical inference and who would like to add the Bayesian perspective to enrich their research.

Learning outcomes

At the end of the course, participants should be able to:

  • Recognise the core components of a Bayesian model
  • List the main concepts of methods for Bayesian inference
  • Implement a simple Bayesian model in R
  • Interpret the results of a Bayesian model

Prerequisites

Knowledge / competencies

Being at ease with R is absolutely required for this course (at least equivalent to the First steps with R SIB course). Basic knowledge of statistical inference (for instance, equivalent to the Introduction to statistics SIB course) is also required.

Both pre-requisites are also taught by the ETHZurich course introduction to statistics and R

Technical

You are required to bring your own laptop and make sure that the following software is installed PRIOR to the course:

  • A recent verion of R and RStudio (the free version is more than enough).

Additionally, make sure to have the following R libraries installed:

Application

The registration fees for the 3 full-days for academics are 120 CHF and 600 CHF for for-profit companies.

While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.

You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.

Applications close on 30/09/2022 or as soon as the course is full. Deadline for free-of-charge cancellation is set to 14/11/2022. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.

Venue and Time

This course will be in person only at the University of Basel on Days 1 and 2, and online only on Day 3.

The course will start at 9:00 and end around 17:00.

More information will be provided to the registered participants in due time.

Additional information

Coordination: Patricia Palagi

We will recommend 0.75 ECTS credits for this course (given that a successful evaluation is achieved at the end of the course).

You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.

Please note that participation in SIB courses is subject to our general conditions.

SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.

For more information, please contact training@sib.swiss.