ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Protein Bioinformatics: Sequence-Structure-Function

18 - 20 November 2020
Streamed
Cancellation deadline:
11 November 2020
Elisabeth Gasteiger, Marie-Claude Blatter, Pascale Gaudet, Christian Sigrist, Christian von Mering, Amos Bairoch, Lydie Lane, Gerardo Tauriello, Ivo Pedruzzi
Academic: 120 CHF
For-profit: 600 CHF
Applications are closed because the course is full with a long waiting list or has just passed. to receive notification when a new course is scheduled.
CLOSED

No future instance of this course is planned yet

The course is now full with a waiting list. Applications are closed. Thank you for your understanding.

This course will be streamed only for the registered participants. Registered participants will receive specific information directly from the respective course’s organizers.

Overview

Sequence-structure-function relationships of proteins are central to a comprehensive understanding of cellular biology. However, many proteins lack direct and detailed information regarding structure, function, and complex formation. This knowledge gap can be overcome through clearly defined relationships between proteins and the integration of existing data.

Participants will be introduced to primarily web-based tools, designed for life scientists without substantial computational training, for integration and inference of protein structure and function data. The lectures and workshops will be led by the SIB developers of these methods, with specific emphasis on translating this training to the participants' own research questions.

Audience

This course is intended for a wide audience covering Master and PhD students, post-docs, and senior researchers in all areas of life science.

Learning objectives

At the end of the course, participants will be able to:

  • identify proteins related by sequence and/or structure and integrate functional annotations from public databases
  • develop homology models of protein structure, assess their quality, and make inferences regarding function and regulation
  • integrate and interpret protein-protein interaction data
  • apply these methods to their own proteins of interest

Prerequisites

Knowledge / competencies

This course is designed for beginners and knowledge of UNIX is not necessary.

Technical

Participants should have a laptop with wireless connectivity and make sure they have the permission to install software if necessary.

Application

The course is for the moment full. if you want to be put into the waiting list, please apply and fill in the form. You will only be recontacted if a place becomes available.

The registration fees for academics are 120 CHF and 600 CHF for for-profit companies.

Deadline for registration and free-of-charge cancellation is set to 11 November 2020. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to our general conditions.

You will be informed by email of your registration confirmation.

Venue and Schedule

The course will be a streamed event. The connection information will be communicated to participants following the acceptation of their registration.

The course will take place for two and a half day, between 09:00 and 17:00, with a 1 hour break at noon.

Wednesday 18 :

  • morning : UniprotKB and sequence annotation, by Marie-Claude Blatter and Elisabeth Gasteiger
  • afternoon : PROSITE, HAMAP, InterPro and automated annotation, by Christian Sigrist and Ivo Pedruzzi

Thursday 19 :

  • morning : neXtProt and the characterization of human proteins, by Lydie Lane, and Amos Bairoch
  • afternoon : STRING db, and PPI network, by christian von Mering

Friday 20 :

  • morning : SWISS MODEL, protein structure modelling, by Gerardo Tauriello

Additional information

Coordination: Wandrille Duchemin

You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.

SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.

For more information, please contact training@sib.swiss.