ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Good practice in high-throughput experiments
16 September 2019
For-profit: 600 CHF
No future instance of this course is planned yet
Overview
This course offers an overview of good practice in high-throughput experiments (e.g. next-generation sequencing or compound screening). Particularly we focus on pitfalls in the design of projects (e.g. too low sample size or sequencing coverage, or sample batches overlap with biological groups), how to successfully plan an experiment and how to deal with challenges, e.g. batch effects or confounding factors. The workshop addresses the experimental as well as the data analysis components through the complete life cycle of a project, from the initial idea all the way to publication.
Audience
Scientists with all backgrounds (biologists, biochemists, clinicians, bioinformaticians, etc) are welcome to join this course. In particular, those who are about to plan and execute an high-throughput experiment can benefit the most.
Learning objectives
At the end of the course participants should be able to:
- Successfully design high-throughput experiments
- Avoid common pitfalls
- Detect and deal with challenges
Prerequisites
Knowledge / competencies
Basic theoretical knowledge in biology/biochemistry/computational analysis. No particular computational or wet lab experience is necessary.
Technical
Participants should bring their own internet-capable laptop or mobile device.
Application
The registration fees for academics are 120 CHF and 600 CHF for for-profit companies. This includes course content material and coffee breaks.
Deadline for registration and free-of-charge cancellation is set is set to 16/09/2019. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation.
Venue and Time
ETH center, LFW B 2, Universitätsstrasse 2, 8092 Zurich
The course will start at 10:00 and end around 16:00. Precise information will be provided to the participants on due time.
Additional information
Instructors:
- Dr. Michael Prummer (NEXUS Personalized Health Technologies, ETHZ)
- Dr. Eva Riegler (NEXUS Personalized Health Technologies, ETHZ)
- Dr. Franziska Singer (NEXUS Personalized Health Technologies, ETHZ)
Coordination: Patricia Palagi
A certificate of attendance will be delivered to the participants attending the workshop in full.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.